Effect of mitochondrial targeting signal and phosphodiesterase activity of CNP2 on its inhibitory property against HIV-1 assembly

doi:10.3877/cma.j.issn.1674-1358.2016.03.028

Abstract

Abstract:

Objective

To confirm whether the mitochondrial targeting and phosphodiesterase activity of CNP2 affect its inhibitory ability against HIV-1 assembly.

Methods

Vector expressing wild type CNP2 with N-terminal FLAG tag was constructed by RT-PCR of CNP2 coding region from Huh7 cell and subsequently inserted into eukaryotic expressing vector pcDNA5 to get pcDNA5-Flag-CNP2. CNP1 and CNP2 mutants CNP2-S9/22A, CNP-2HM was constructed by PCR based mutagenesis and inserted into the same vector. CNP constructs was respectively transfected into 293T cell with pseudotyped HIV-1 particle assemble vectors pLP1, pLP2, pLP/VSVG, pLenti6-EGFP. Pseudotyped HIV-1 particle titer was tested by foci formation after infection of 293T cell and also estimated particle p24 by Western blot. TP55 gag precursor and p24 in transfected cell were tested by Western blot.

Results

CNP2, CNP1 and CNP2-S9/22A could potently inhibit HIV titers in transfection supernant (t = 58.23, 17.24, 12.77, 6.131; P = 0.0035, 0.0066, 0.0004, 0.0039). The inhibitory property of CNP1 without mitochondrial targeting signal was more potently than CNP2. 2HM mutant losing phosphodiesterase activity could only minimally inhibit HIV-1 assembly.

Conclusions

CNP2 inhibition of HIV-1 assembly needs the phosphodiesterase activity, and mitochondrial targeting signal could modulate the inhibitory function.

Key words: 2’, 3’-cyclic nucleotide phosphodiesterase (CNP), HIV-1 particle assembly, Mitochondrial targeting signal, Phosphodiesterase activity.

Shuntao Liang, Guorui Dai, Rui Li, Dong Jiang, Hui Zeng. Effect of mitochondrial targeting signal and phosphodiesterase activity of CNP2 on its inhibitory property against HIV-1 assembly[J]. Chinese Journal of Experimental and Clinical Infectious Diseases(Electronic Edition), 2016, 10(03): 380-384.

/ / Recommend

Add to citation manager EndNote|Ris|BibTeX

URL: https://zhsyhlcgrbzz.cma-cmc.com.cn/EN/10.3877/cma.j.issn.1674-1358.2016.03.028

https://zhsyhlcgrbzz.cma-cmc.com.cn/EN/Y2016/V10/I03/380

Figures/Tables 6

References 27

1	Nasr N, Maddocks S, Turville SG, et al. HIV-1 infection of human macrophages directly induces viperin which inhibits viral production[J]. Blood,2012,120(4):778-788.
2	Perez-Caballero D, Zang T, Ebrahimi A, et al. Tetherin inhibits HIV-1 release by directly tethering virions to cells[J]. Cell,2009,139(3):499-511.
3	Schoggins JW, Rice CM. Interferon-stimulated genes and their antiviral effector functions[J]. Curr Opin Viro,2011,1(6):519-925.
4	Rosa A, Chande A, Ziglio S, et al. HIV-1 Nef promotes infection by excluding SERINC5 from virion incorporation[J]. Nature,2015,526(7572):212-217.
5	Powell RD, Holland PJ, Hollis T, et al. Aicardi-Goutieres syndrome gene and HIV-1 restriction factor SAMHD1 is a dGTP-regulated deoxynucleotide triphosphohydrolase[J]. J Bio Chem,2011,286(51):43596-43600.
6	Pincetic A, Kuang Z, Seo EJ, et al.The interferon-induced gene ISG15 blocks retrovirus release from cells late in the budding process[J]. J Virol,2010,84(9):4725-4736.
7	Monroe KM, Yang Z, Johnson JR, et al. IFI16 DNA sensor is required for death of lymphoid CD4 T cells abortively infected with HIV[J]. Science,2014,343(6169):428-432.
8	Goncalves A, Karayel E, Rice GI, et al. SAMHD1 is a nucleic-acid binding protein that is mislocalized due to aicardi-goutieres syndrome-associated mutations[J]. Hum Mutat,2012,33(7):1116-1122.
9	Gao P, Ascano M, Wu Y, et al. Cyclic [G(2’,5’)pA(3’,5’)p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase[J]. Cell,2013,153(5):1094-1107.
10	Yu J, Li M, Wilkins J, et al. IFITM proteins restrict HIV-1 infection by antagonizing the envelope glycoprotein[J]. Cell Rep,2015,13(1):145-156.
11	White TE, Brandariz-Nunez A, Valle-Casuso JC, et al. Contribution of SAM and HD domains to retroviral restriction mediated by human SAMHD1[J]. Virology,2013,436(1):81-90.
12	Usami Y, Wu Y, Gottlinger HG. SERINC3 and SERINC5 restrict HIV-1 infectivity and are counteracted by Nef[J]. Nature,2015,526(7572):218-223.
13	Sun L, Wu J, Du F, et al. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway[J]. Science,2013,339(6121):786-791.
14	Seo JY, Yaneva R, Hinson ER, et al. Human cytomegalovirus directly induces the antiviral protein viperin to enhance infectivity[J]. Science,2011,332(6033):1093-1097.
15	Wu CY, Lu J, Cao Q, et al. Expression of 2’,3’-cyclic nucleotide 3’-phosphodiesterase in the amoeboid microglial cells in the developing rat brain[J]. Neuroscience,2006,142(2):333-341.
16	Lee J, O’Neill RC, Park MW, et al. Mitochondrial localization of CNP2 is regulated by phosphorylation of the N-terminal targeting signal by PKC: implications of a mitochondrial function for CNP2 in glial and non-glial cells[J]. Mol Cell Neurosci,2006,31(3):446-462.
17	Wilson SJ, Schoggins JW, Zang T, et al. Inhibition of HIV-1 particle assembly by 2’,3’-cyclic-nucleotide 3’-phosphodiesterase[J]. Cell Host Microbe,2012,12(4):585-597.
18	Gravel M, Robert F, Braun PE. 2’,3’-Cyclic nucleotide 3’-phosphodiesterase: a novel RNA-binding protein that inhibits protein synthesis[J]. J Neurosci Res,2009,87(5):1069-1079.
19	Myllykoski M, Itoh K, Kangas SM, et al. The N-terminal domain of the myelin enzyme 2’,3’-cyclic nucleotide 3’-phosphodiesterase: direct molecular interaction with the calcium sensor calmodulin[J]. J Neurochem,2012,123(4):515-524.
20	Siegal FP, Kadowaki N, Shodell M, et al. The nature of the principal type 1 interferon-producing cells in human blood[J]. Science,1999,284(5421):1835-1837.
21	Schoggins JW, Wilson SJ, Panis M, et al. A diverse range of gene products are effectors of the type I interferon antiviral response[J]. Nature,2011,472(7344):481-485.
22	Espert L, Degols G, Mechti N. Interferon-induced exonuclease ISG20 exhibits an antiviral activity against human immunodeficiency virus type 1[J]. J Gen Virol,2005,86(Pt 8):2221-2229.
23	Doitsh G, Galloway NL, Geng X, et al. Cell death by pyroptosis drives CD4 T-cell depletion in HIV-1 infection[J]. Nature,2014,505(7484):509-514.
24	Gao D, Wu J, Wu YT, et al. Cyclic GMP-AMP synthase is an innate immune sensor of HIV and other retroviruses[J]. Science,2013,341(6148):903-906.
25	Denner J, Eschricht M, Lauck M, et al. Modulation of cytokine release and gene expression by the immunosuppressive domain of gp41 of HIV-1[J]. PloS One,2013,8(1):e55199.
26	Beloglazova N, Flick R, Tchigvintsev A, et al. Nuclease activity of the human SAMHD1 protein implicated in the Aicardi-Goutieres syndrome and HIV-1 restriction[J]. J Bio Chem,2013,288(12):8101-8110.
27	Ryan C, O’Neill JM, Peter EB. CNP2 mRNA Directs Synthesis of Both CNP1 and CNP2 Polypeptides[J]. J Neurosci Res,1997,50(2):248-257.

引物名称	序列
Bam H Ⅰ-CNP2+	5'-CACGGATCCATGAACAGAGGCTTCTCCCG-3'
Bam HⅠ-CNP2-S9/22A+	5'-CACGGATCCATGAACAGAGGCTTCTCCCGAAAAGCCCACACATTCCTGCCCAAGATCTTCTTCCGCAAGATGGCATCCTCAGGGGCCAAGGACAAG-3'
Bam HⅠ-CNP1+	5'-CACGGATCCATGTCATCCTCAGGGGCCAAG-3'
CNP2-2HM+	5'-GGAAAGAGACCCCCAGGCGTGCTGGCTGCCGCAACCAAGTTTTGTGACTACGGG-3'
CNP2-2HM-	5'-CTACGTCAGCTGCACAGCCGAGGGCGGCGGCGGCGCGGCTCCCCCGCGGCAGG3'
Not Ⅰ-CNP2-	5'- CACGCGGCCGCTCATATGATGGTGCAGGACT -3'

引物名称	序列
Bam H Ⅰ-CNP2+	5'-CACGGATCCATGAACAGAGGCTTCTCCCG-3'
Bam HⅠ-CNP2-S9/22A+	5'-CACGGATCCATGAACAGAGGCTTCTCCCGAAAAGCCCACACATTCCTGCCCAAGATCTTCTTCCGCAAGATGGCATCCTCAGGGGCCAAGGACAAG-3'
Bam HⅠ-CNP1+	5'-CACGGATCCATGTCATCCTCAGGGGCCAAG-3'
CNP2-2HM+	5'-GGAAAGAGACCCCCAGGCGTGCTGGCTGCCGCAACCAAGTTTTGTGACTACGGG-3'
CNP2-2HM-	5'-CTACGTCAGCTGCACAGCCGAGGGCGGCGGCGGCGCGGCTCCCCCGCGGCAGG3'
Not Ⅰ-CNP2-	5'- CACGCGGCCGCTCATATGATGGTGCAGGACT -3'

Please choose a citation manager

Content to export